DNA

DNA Strand:


AGTTTTTAAGCACGCGGGCGAGCTTTGCACTCACGGTAG

Historical Influences on Darwin: BACKGROUND

Introduction to Charles Robert Darwin:

                Darwin was born on February 12, 1809 in Shrewsbury, England. As a kid Darwin seemed really interested on living organisms such as the beetle. At the age of 16 Darwin’s father Robert Darwin decided to send his son to Edinburgh University where he would study medicine. Darwin soon discovered that he did not liked medicine because of his repulsion to surgery. Later his father sent him to the University of Cambridge where he would study to become a clergyman; however he seemed uninterested in that idea also as he kept doing poorly at school. Surprisingly in Cambridge Darwin was able to find his passion when he was introduced to the world of science by John Stevens Henslow his biology professor. Soon Darwin was invited to the HMS Beagle voyage (1831) which was a five year traveled around the world and in that trip was when Darwin started to come up with the idea of evolution. Charles Darwin was a great contributor to psychology and to society as a whole.  He changed the way science viewed the existence of humans in this world. Charles Darwin died on April 19, 1882 and was buried in Westminster Abbey.

“Ignorance more frequently begets confidence than does knowledge: it is those who know little, and not those who know much, who so positively assert that this or that problem will never be solved by science.”

http://faculty.frostburg.edu/mbradley/psyography/charlesdarwin.html

      1)      Introduction to Thomas Malthus and Darwin’s Inspiration:

Thomas Robert Malthus was born near Guildford; Surrey in February 1766. As a kid Malthus was homeschooled by his father; later on Malthus went off to Cambridge University and in 1805 he became a professor of history and political economy at the East India Company's college in Haileybury, Hertfordshire. Malthus was well known for his work The Principles of Population which was publish in 1798.  The work of Malthus in The Principles of Population was an important and inspiring essay in the work of Darwin, since Malthus was arguing about the of human population growth. Associated with Darwin, whose theory of natural selection was influenced by Malthus' analysis of population growth, Malthus was often misinterpreted, but his views became popular again in the 20th century with the advent of Keynesian economics. Malthus died on 23 December 1834.

http://www.bbc.co.uk/history/historic_figures/malthus_thomas.shtml

http://www.ucmp.berkeley.edu/history/malthus.html

2    2)      Malthus Influence on Science

                Thomas Malthus was influential in political economy and demography since Malthus popularizes the economic theory of rent. On his essay The Principle of population Malthus observed that sooner or later populations die either by Famine (Scarcity of Food) and disease. Malthus thought that if population would of increase out of control then there would be dangers that would prevent the progress towards utopian society. Malthus wrote: "The power of population is indefinitely greater than the power in the earth to produce subsistence for man".

http://www.princeton.edu/~achaney/tmve/wiki100k/docs/Thomas_Malthus.html

      3)      Points Identified with Malthus

•  All organisms have the potential of reproducing exponentially. Malthus proved that population can’t grow exponentially to their potential because population can increase in size, but the amount of resources (Food, Water, etc.) will stay constant making things unbalanced.
•  What is preventing organisms from reproducing at their potential? Malthus proved that population will always be affected by famine and disease.
•  Resources are limited. Malthus proved that one of the main reasons of controlled reproduction is because resources will always keep constant; therefore they will not increase.
• Organisms with better access to resources will be more successful in their reproductive efforts. No because Malthus proving resources constant will control reproduction of living things.

      4)      Darwin’s Work Based on Malthus

 Darwin couldn’t have developed his theory of natural selection without Malthus’ work because in Malthus’ work Darwin discovered and recognized the important fact that when population size is limited by resource availability, there is constant competition. This was a crucial point, since completion plays a big role in natural selection.

      5)      Church’s Attitude on Darwin’s Work The Origin of Species

The attitude of the church towards Darwin’s work in The Origin of Species was not positive because there was a mix-up between what church believe on the existence of humans and what Darwin Presented in his paper. Church thought that Darwin would just confuse the people but from a scientific perspective Darwin was supported by many people and scientist. There was also a debate on what theories were kids on school were going to be thought (Darwin’s theory or the Church’s theory). It ended up being that schools were going to teach Darwin’s theory on human existence because it seemed logical and it was scientific containing facts based on observations.