Carlos, you were missing start and stop codons, so I didn't know where to start decoding your sentence. By the rules of protein synthesis, I had to start at the beginning and it just made nonsense.
I'm glad Indigo Blue was able to figure it out, but I'm curious as to how he did it? Remember that you can use these opportunities to help guide other students, so if you see an error in the assignment, you should feel free to politely explain the mistakes.
Here is my decode for reference, such that it is, keeping in mind that the decode had to start from the beginning (or not at all, actually) since there was no start codon:
DNA: AGTTTTTAAGCACGCGGGCGAGCTTTGCACTCACGGTAG RNA: UCA AAA AUU CGU GCG CCC GCU CGA AAC GUG AGU GCC AUC And delirium students learn confusing want us evolve anthropology we ape good book.
This was a tough one to break, and it only happened because I kept playing around with it for a good while. In all honesty, I refused to move onto another student's DNA strand, as I had already invested too much time into this one. When I transcribed to RNA I ended with: AGUUUUUAAGCACGCGGGCGAGCUUUGCACUCACGGUAG. Once I could figure out your key, then it became easier, and of course I used some imagination into what you may be expressing. That and good luck helped me.
Posts
I think it is: In an unusual twist Natural Selection evolved us to think and adapt.
ReplyDeleteThe sentence you wrote it's correct that was what my original sentence was great job.
ReplyDeleteCarlos, you were missing start and stop codons, so I didn't know where to start decoding your sentence. By the rules of protein synthesis, I had to start at the beginning and it just made nonsense.
ReplyDeleteI'm glad Indigo Blue was able to figure it out, but I'm curious as to how he did it? Remember that you can use these opportunities to help guide other students, so if you see an error in the assignment, you should feel free to politely explain the mistakes.
Here is my decode for reference, such that it is, keeping in mind that the decode had to start from the beginning (or not at all, actually) since there was no start codon:
DNA: AGTTTTTAAGCACGCGGGCGAGCTTTGCACTCACGGTAG
RNA: UCA AAA AUU CGU GCG CCC GCU CGA AAC GUG AGU GCC AUC
And delirium students learn confusing want us evolve anthropology we ape good book.
This was a tough one to break, and it only happened because I kept playing around with it for a good while. In all honesty, I refused to move onto another student's DNA strand, as I had already invested too much time into this one. When I transcribed to RNA I ended with: AGUUUUUAAGCACGCGGGCGAGCUUUGCACUCACGGUAG. Once I could figure out your key, then it became easier, and of course I used some imagination into what you may be expressing. That and good luck helped me.
ReplyDeleteGood one!