Human Variation & Race

1. Select only ONE of the following environmental stresses: (a) heat, (b) high levels of solar
radiation, (c) cold, or (d) high altitude. Discuss specifically how this environmental stress
negatively impacts the survival of humans by disturbing homeostasis. (5 pts)

Cold environments can affect a person in a negative way and affect people’s survival because if a person does not have the specific requirements needed to survive these cold circumstances then the person can die from hypothermia giving the advantage to the people with a greater body mass. 

2. Identify 4 ways in which humans have adapted to this stress, choosing one specific adaptation
from each of the different types of adaptations listed above (short term, facultative,
developmental and cultural). Include images of the adaptations. (5 pts each/ 20 pts total)

For the cold environments humans have adapted different ways to survive:
a)    Clothing has played a big role for lean people to survive in the cold environments since it helps lean people be able to survive through the winter.

b)     Shivering or shaking being an involuntary movement of the body and also being short term which tries to warm up the body.

c)    Exercising is another form in which people are able to keep their body temperature warm by running, jogging, etc.
 
d)    Some people are able to keep warm by having a great amount of body mass which helps make insulation for the cold environment.




3. What are the benefits of studying human variation from this perspective across environmental
clines? Can information from explorations like this be useful to help us in any way? Offer one
example of how this information can be used in a productive way. (5 pts)

The benefits of studying these variations are that we can learn why we seemed to have diversity in the way we look even though we are not different at all. The investigation on different environments can be useful to be able to help us adapt in different climate areas. One example can be the different seasons of the year winter, autumn, spring, summer

4. How would you use race to understand the variation of the adaptations you listed in #2? Explain why the study of environmental influences on adaptations is a better way to understand human variation than by the use of race. (10 pts)

It is really difficult to narrow down to a specific group of people because anyone can wear clothing to be warm; also people have great body mass even if they don’t need it like we have in the U.S. where obesity is growing exponentially. Exercising anyone can do it does not have to be a specific race and shivering that is a mechanism use by everyone when the body is cooling down. In my opinion these circumstances described by me would be really difficult to narrow people by a certain race. But by looking at environmental influences people are able to understand why people look the way they look as in why they have a great amount of body mass or why do they dress the way they do etc.

Language

Part 1: You were asked to engage in a conversation for 15 minutes where you were not allowed to use any version of a symbolic language (no speaking, writing, or ASL).

-Did you find this experiment difficult or easy? Explain. (5 pts)

This experiment was extremely difficult. I truly found myself frustrated because I felt the need to speak as I felt I wasn’t being understood on what I was trying to say; I had to basically act out what I was trying to say which took a lot of time and it was extremely tedious only for one sentence. It was also complicated for people to understand what I needed to tell them.  

-What were the impressions of partners in the conversation? Did they alter their way of communicating with you because of your absence of symbolic communication? Describe. (5 pts)

The impressions on the people involved in the experiment were confused expressions since they did not know majority of the times what I was trying to say, they seemed puzzled but they did not give up because this was only an experiment like I’ve had told them. They did alter their way of communication a little because after so many tries of trying to guess what I was trying to say they seem a little frustrated.

- Imagine that you and your partners in the conversation represent two different cultures meeting for the first time. Which culture has the advantage in communicating complex ideas? What attitudes might the speaking culture have toward the culture that does not use symbolic language? Identify individuals in our culture that have difficulty communicating with spoken language and explore how that affects how those who do speak interact with those individuals. (10 pts)

The culture with a greater advantage is the one who comes from a highly educated culture and advanced since it has different ways to communicate and might have more knowledge on other cultures. The speaking culture might have trouble understanding the culture that does not use symbolic language because 50% of language we express is symbolic to be able to understand what we are trying to express. The individuals that we have difficulty communicating with is the people that are not able to speak because the only way they can communicate is with ASL which not all people like myself know that language even though it’s within our culture.   

Part 2: You were asked to spend 15 minutes communicating without any physical embellishments, i.e., no hand signals, not vocal intonation, not head, facial, or body movements. 

-Were you able to last for the full 15 minutes of using only speech for communicating? What made this experiment difficult for you? (5 pts)

This task was not easy for me since I could not even last 2 minutes without using a body and face expression. Every time I make a statement or a sentence I am used to make a body movement or face expression which I could not be accustomed to not use any expression when talking to my friends. Doing this kind of expressions make me feel like I am making my point through and if I don’t make any kind of expression I feel like they did not understand what I tried to say.
   
- How were your partners in this part of the experiment affected by your communication limitations? Explain. (5 pts)

When I stated speaking to them not making any expressions they found it extremely unusual and kind of weird because they are not used to see me speaking plainly in a way. They also had a hard time paying attention to me because they often dozed off and did not completely understand what my point was.

- What does this experiment say about our use of “signs” in our language, i.e., how important is non-speech language techniques in our ability to communicate effectively? (5 pts)

Both languages verbal and no verbal are important in communication because we are able to make a point more clearly by using both expressions since 50% of the time we use body language and the other 50% of the time is spoken.

- Are there people who have difficulty reading body language? Describe the adaptive benefit to possessing the ability to read body language. Can you describe environmental conditions where there might be a benefit to not reading body language? (5 pts)

There are people who have difficulty reading body language.  The adaptive benefit to possessing the ability to read body language is a big help because many people depend on body language not just words. Body language can be convenient in many cases where not much has to be necessarily expressed via speech. Some things that can be expressed are feelings like anger, happiness, and many more. This can be really helpful in many ways because a person has no need to speak and can be noticeable making the others aware, if they can get close to them or not. I think that where it could be helpful not knowing how to read body language is when someone is going to make a deal or buying something because no one wants to show emotions since price will increase if someone shows they want something so bad.

Piltdown Hoax

The Piltdown man hoax was a fossil skull found in Piltdown a village on England which it was said to be the missing link between apes and humans since it seemed to have human teeth but an ape jaw. A laborer found a strange piece of skull which it was passed to Charles Dawson. The Piltdown man hoax was a devastating thing for scientist and they thought it was a horrible and nasty basically a vicious piece of art. The hoax was created to gain credibility it was a selfish way of thought since this discovery only harmed the research instead of helping, because it was made up. Two scientists collaborated on this discovery of the so call missing link one of them was Charles Dawson and also Sir Arthur Smith Woodward. These two scientists took advantage of Britain’s desperation on finding fossils of early human presence because they wanted to gain credibility and be recognized for the discovery.

                The Piltdown man hoax was a selfish piece of art made by a creative scientist. This skull made some things clear of “the missing link” since it was said to be par ape and part human. What scientist did not do was to inspect the skull and to learn more from it, sure they did not have carbon dating or radiometric dating to learn how old the skull was, but the one thing they had the means to do it look at the teeth which was one of the breaking point in knowing that was an ape skull. What also was not right to do is keeping the skull away from everyone and keeping it at the museum because if the scientist from the natural museum in Britain would have let other scientist give their opinion on the skull then there would not have been any confusion as in what kind of skull it was. What also seemed to happen was that because Britain wanted to also have early signs of human presence they did not wanted to research the skull any further.

                With a series of chemical test applied by Kenneth Oakley to help authenticate and date the fossils (radiometric dating) which revealed that the fossil was much younger than expected. In the mineral department test were carried out to determine the content of nitrogen. The skull seemed to be older than it was because it was stained. Another factor that contributed to this case was when they found out that the teeth were boiled and carefully filed down to look human like then paint colored to give that age look. And one of the canine teeth which were made in a rush was partially suspicious which lead to the investigation of the others.

                It is not possible to remove the human factor from science to reduce the chance of errors. If humans were to be removed from this chain then how would we know where we’ve come from? There are proof that humans and apes shared a common ancestor which indeed seems to be part human and part ape the so call “missing link”. Also in order for us humans to evolve from apes there had to be early signs of human traits on apes otherwise we could not have evolved from humans. In order for us to share a common ancestor we need to have a great amount of similar physical attributes.

                What I have learned from this is that I should not rely on unverified resources because even though I might have what I need for my research it might not be true. What I also learned is that any information given must be verified by many people because it might end up being fake.  

Comparative Primate

Lemurs

·         Lemurs live in Madagascar and the neighboring Comoro Islands they spend most of their time at the top of the rain forest.

·         Lemurs do not have prehensile tails (meaning they can’t hang themselves from trees with their tail) lemurs have a good sense of vision which is better at night.

·         The lemur adaptation to eat fruits, leaves, and other edible plants as well as small insects come in handy in the rain forest because it is abundant with many of the lemurs diet.

Spider Monkey

·         Spider monkeys live in tropical climates, such as the evergreen forest in South America as well as Far North in Mexico living in the upper canopy of trees.

·         Spider monkeys have long lanky arms they also do not have thumbs; however, the patch of the end of their tails works similar to fingers increasing their griping ability.

·         Spider monkeys are omnivorous they are specially categorized fruigivorous because they base on fruit and seed where in their habitat is pretty abundant.       

                                                                                        

           Baboon

·         Baboons live on East Africa they are the most adaptable on the ground of all primates and can live on a variety of habitats.

·         Baboons do not have prehensile tail but they can climb trees easily, baboons are dogfaced.

·         Baboons are omnivores and selective feeders (they choose what to eat). Grass makes a part of their diet along with berries, and seeds, as well as a variety of plants. They also eat insects, fish, birds, vervet monkeys and young, small antelopes giving them a special adaptation to survival in their particular environment.

           Gibbon

·         Gibbons live in Laos, Vietnam, and Southern China living on evergreen forest and monsoon forest, they spend much of their time in the canopy they rarely go to the ground.

·         Gibbons have strong hook-shaped hands for grasping branches; shoulder joints are specially adapted to have a greater range of motion allowing them to swing faster from branch to branch perfect for their environment.

·         Gibbon’s diet consists of ripe fruits, leaves, and small amount of invertebrates this quality of eating maintains them in the canopy raising their chances of survival.

            Chimpanzee

·         Chimpanzees live across a west belt in equatorial Africa; they live in a wide variety of habitats including dry savannas, evergreen forest, montane forest, swamp forest, and dry woodland-savanna mosaics.

·         Chimpanzees are quadrupedal knuckle walking and occasionally bipedalism; chimpanzees are both terrestrial and arboreal.

·         Chimpanzees are frugivores they prefer to eat frutes and seeds they supplement their vegetarian diet with insects, birds, birds eggs, honey, soil, and small medium sized animals including primates this is helpful because even though their main diet is frugivore they can adapt to eat other things.

 

      Summary:

In conclusion I believe all these primates have a very similar trait on diet they are mostly frugivores but they can adapt to other means of food. They also live on trees and their abilities for climbing come in handy. Most live on the canopy only two have adapted to live on ground and trees. They are also very territorial.

Resources:

http://pin.primate.wisc.edu/factsheets/entry/chimpanzee

http://nationalzoo.si.edu/animals/primates/facts/fact-white-cheeked-gibbon.cfm

http://animals.nationalgeographic.com/animals/mammals/gibbon/?rptregcta=reg_free_np&rptregcampaign=20131016_rw_membership_n1p_us_se_w#register

http://www.outtoafrica.nl/animals/engbaboon.html

http://animals.nationalgeographic.com/animals/mammals/baboon/

http://www.macalester.edu/~montgomery/spidermonkey.html

http://www.lemurs.us/basics.html

Analogy and Homology

Homology

Monkeys and humans

A)     The Monkeys and the human being both have been derived from the same ancestor but have evolved in their own different paths. Chimpanzees evolved to survive in the wild alongside many other animals’ elephants, lions, zebras, etc. As for humans being evolved from the ape became in a way more civilized and be able to survive separating humans from the wild.

B)      A homologous trait that both chimpanzees and humans share is in fact that humans have a tail bone which signals that humans use to have a tail at some point and Monkeys have an actual tail which they use to keep balance and be able to sing around between trees having a unique feature. This homologous trait exhibits a difference between the two because humans have evolved to get rid of the tail but monkeys still have it because they need it for survival.

C)      The common ancestor for these two species was, the CHLCA is useful as an anchor point for calculating single-nucleotide polymorphism (SNP) rates in human populations where chimpanzees are used as an out-group. The CHLCA is frequently cited as an anchor for the molecular most recent common ancestor (MRCA) determination because the two species of the genus Pan, the bonobos and the chimpanzee, are the species most genetically similar to Homo sapiens.

http://en.wikipedia.org/wiki/Chimpanzee%E2%80%93human_last_common_ancestor

Analogies

Octopus and sea star

A)     Both of these animals have the limbs that evolved separately not from the same ancestor.

B)      Octopus and starfish both have the libs with suction cups that allow them to attach to any surface.

C)      These limbs are not similar in structure which signals that they evolved them individually and it was not from the same ancestor since they evolved independently.

DNA

DNA Strand:


AGTTTTTAAGCACGCGGGCGAGCTTTGCACTCACGGTAG

Historical Influences on Darwin: BACKGROUND

Introduction to Charles Robert Darwin:

                Darwin was born on February 12, 1809 in Shrewsbury, England. As a kid Darwin seemed really interested on living organisms such as the beetle. At the age of 16 Darwin’s father Robert Darwin decided to send his son to Edinburgh University where he would study medicine. Darwin soon discovered that he did not liked medicine because of his repulsion to surgery. Later his father sent him to the University of Cambridge where he would study to become a clergyman; however he seemed uninterested in that idea also as he kept doing poorly at school. Surprisingly in Cambridge Darwin was able to find his passion when he was introduced to the world of science by John Stevens Henslow his biology professor. Soon Darwin was invited to the HMS Beagle voyage (1831) which was a five year traveled around the world and in that trip was when Darwin started to come up with the idea of evolution. Charles Darwin was a great contributor to psychology and to society as a whole.  He changed the way science viewed the existence of humans in this world. Charles Darwin died on April 19, 1882 and was buried in Westminster Abbey.

“Ignorance more frequently begets confidence than does knowledge: it is those who know little, and not those who know much, who so positively assert that this or that problem will never be solved by science.”

http://faculty.frostburg.edu/mbradley/psyography/charlesdarwin.html

      1)      Introduction to Thomas Malthus and Darwin’s Inspiration:

Thomas Robert Malthus was born near Guildford; Surrey in February 1766. As a kid Malthus was homeschooled by his father; later on Malthus went off to Cambridge University and in 1805 he became a professor of history and political economy at the East India Company's college in Haileybury, Hertfordshire. Malthus was well known for his work The Principles of Population which was publish in 1798.  The work of Malthus in The Principles of Population was an important and inspiring essay in the work of Darwin, since Malthus was arguing about the of human population growth. Associated with Darwin, whose theory of natural selection was influenced by Malthus' analysis of population growth, Malthus was often misinterpreted, but his views became popular again in the 20th century with the advent of Keynesian economics. Malthus died on 23 December 1834.

http://www.bbc.co.uk/history/historic_figures/malthus_thomas.shtml

http://www.ucmp.berkeley.edu/history/malthus.html

2    2)      Malthus Influence on Science

                Thomas Malthus was influential in political economy and demography since Malthus popularizes the economic theory of rent. On his essay The Principle of population Malthus observed that sooner or later populations die either by Famine (Scarcity of Food) and disease. Malthus thought that if population would of increase out of control then there would be dangers that would prevent the progress towards utopian society. Malthus wrote: "The power of population is indefinitely greater than the power in the earth to produce subsistence for man".

http://www.princeton.edu/~achaney/tmve/wiki100k/docs/Thomas_Malthus.html

      3)      Points Identified with Malthus

•  All organisms have the potential of reproducing exponentially. Malthus proved that population can’t grow exponentially to their potential because population can increase in size, but the amount of resources (Food, Water, etc.) will stay constant making things unbalanced.
•  What is preventing organisms from reproducing at their potential? Malthus proved that population will always be affected by famine and disease.
•  Resources are limited. Malthus proved that one of the main reasons of controlled reproduction is because resources will always keep constant; therefore they will not increase.
• Organisms with better access to resources will be more successful in their reproductive efforts. No because Malthus proving resources constant will control reproduction of living things.

      4)      Darwin’s Work Based on Malthus

 Darwin couldn’t have developed his theory of natural selection without Malthus’ work because in Malthus’ work Darwin discovered and recognized the important fact that when population size is limited by resource availability, there is constant competition. This was a crucial point, since completion plays a big role in natural selection.

      5)      Church’s Attitude on Darwin’s Work The Origin of Species

The attitude of the church towards Darwin’s work in The Origin of Species was not positive because there was a mix-up between what church believe on the existence of humans and what Darwin Presented in his paper. Church thought that Darwin would just confuse the people but from a scientific perspective Darwin was supported by many people and scientist. There was also a debate on what theories were kids on school were going to be thought (Darwin’s theory or the Church’s theory). It ended up being that schools were going to teach Darwin’s theory on human existence because it seemed logical and it was scientific containing facts based on observations.